Forensic DNA Analysis

Forensics, pertaining to the courts either criminal or civil Forensics DNA analysis is the use of DNA evidence Used in: paternity suites victim identification identifying suspects

Originally identification was limited to: Physical attributes such as; ethnicity, gender, height, weight, hair color, etc. Friction-ridge identification or fingerprinting Blood-antigen & serum proteins, ABO blood groups

Even though two unrelated humans differ in their DNA only by 0.1 to 0.2% there are still up to 6 million basepair differences It is these differences that are used to create a unique DNAfingerprint also known as DNA profile

Restriction Fragment Length Polymorphism (RFLP) Detects a single basepair change in DNA Must occur within a restriction enzyme cleavage sequence to be visible Often used in disease screening such as in the detection of sickle cell anemia DNA fragments are often visualized by Southern Blot

RFLP

DNA Fingerprinting First described in 1985 by Alec Jeffreys as a method for identifying individuals by their unique pattern of DNA banding First use of DNA fingerprinting was in a 1985 immigration case in the UK. It identified a child as being the offspring of a British citizen It was then used to rule out a suspect in a rape/murder case in England in 1986

During the late 80s/early 90s US courts questioned the validity of DNA profiling The debates centered on evidence collection procedures, training of technicians, & the statistics used to establish a match By the mid 1990s DNA profiling was shown to be scientifically valid and DNA evidence became admissible

What creates this unique pattern? Satellite DNA: repetitive DNA sequence. Macrosatellite: core sequence 100 to 6500bp Minisatellite: core sequence of 10-20bp repeated multiple times Microsatellite: small arrays of tandem repeats of 2 to 4bp in length (AT)n account for 0.3% of the human genome (CATG)n accounts for 0.5% of the human genome

Repeats of Satellite DNA Repeat units vary in length from 2bp to long stretches of 6000bp or more These repeat units are lined up head to tail and compose satellite DNA and are interspersed throughout the genome The number of units varies person to person Thus these sequences are called VNTRs (variable number of tandem repeats) A VNTR is a locus that is hypervariable due to a large number of alleles each characterized by a different number of repeat units

One Mechanism of VNTR Creation

Southern blotting can be used to visualize the variation Probes specific to the repeat unit are hybridized to DNA cut with a restriction enzyme that cuts just outside the VNTR This allows for the difference in VNTR length to be detected Two common probes are known are: 33.6 (AGGGCTGGAGG) (AGAGGTGGGCAGGTGG) 29 These are multi-locus minisatellite probes and show about 17 different DNA bands for each individual

Multi-loci DNA Fingerprint

Multi-locus analysis of Dolly used to prove she was a clone 1 –12 are control sheep U is original udder cells C is cells from culture D is Dolly blood cells

Single-Locus VNTR Single-locus mini/microsatellite VNTRs generates at most two bands Though not as unique as multi-locus VNTRs they are simple to use Multiple single-locus VNTRs are used to give a DNA fingerprint

Skeletal remains exhumed from a site in Brazil in 1985 that were thought to be those of the Nazi, Josef Mengele The profile of DNA extracted from a femur (F) was compared with those of his son (R) and wife (I) at 10 different loci, & found to be fully compatible with paternity of Mengeles son ActinMfd49

PCR amplification of VNTR PCR is particularly useful in forensic analysis as it allows minute amounts of DNA to be analyzed DNA can be obtained from blood stains, semen, saliva, or hair roots Instead of digesting the DNA PCR is used to amplify the VNTRs and the products are run on a gel and visualized by staining This process requires primers that anneal just outside the VNTR

Short Tandem Repeats (STR) Are a variation on VNTRs, but use the smallest repeats units often only 2 to 4 bp in length aatttttgtattttttttagagacggggtttcaccatgttggtcaggctgactatggagt tattttaaggttaatatatataaagggtatgatagaacacttgtcatagtttagaacgaa ctaacgatagatagatagatagatagatagatagatagatagatagatagatagacagat tgatagtttttttttatctcactaaatagtctatagtaaacatttaattaccaatatttg 13 core loci of tetrameric repeats are tested together to make a DNA profile The sequence above is locus D7S280 which is located on chromosome 7

STRs are isolated using PCR Primers have been developed to allow amplification of multiple STR loci in a single reaction mixture Each primer set has been optimized such that its product, no matter the number of STRs, is not the same size as any of the other products Each primer set has unique fluorescent molecules covalently linked to them so that they may be visualized immediately by a computer

Following the PCR reaction, internal DNA length standards are added to the reaction mixture The DNAs are separated by length in a capillary gel electrophoresis machine As DNA peaks elute from the gel they are detected with laser activation The results are then graphed by a computer which compares them to a standard

Analysis of 3 STRs, D3S1358, vWA, & FGA Reference standards with the known alleles for each STR locus Profile of test subject Genotype is 15, D3S1358, 14, vWA, & 24, FGA

LocusD3S1358vWAFGAD8S1179D21S11D18S51D5S818 Genotype15, 1816, 1619, 2412, 1329, 3112, 1311, 13 Frequency 8.2%4.4%1.7%9.9%2.3%4.3%13% LocusD13S317D7S820D16S539THO1TPOXCSF1POAMEL Genotype11, 1110, 1011, 119, 9.38, 811, 11X Y Frequency 1.2%6.3%9.5%9.6%3.52%7.2%(Male) Example of a DNA profile using the 13 CODIS STR The odds of another person having this profile 1 in 7.7 x 10 15

CODIS (Combined DNA Index System) In 1997, the FBI announced the selection of 13 STR loci to constitute the core of the United States national database, CODIS All forensic laboratories that use the CODIS system can contribute to the national database The STRs alleles are easily genotyped using commercial kits All data from these analyses are digital thus easily placed in the database

Newer Typing Techniques MiniSTR uses shorter PCR primers giving shorter pieces of DNA to analyze. Developed for WTC (World Trade Center) recovery since the DNA recovered from the site was degraded significantly Single Nucleotide Polymorphisms (SNPs) single basepair mutations mainly used in medical analysis, but being modified for forensics. Mitochondrial DNA (mtDNA) analysis of this DNA which is more abundant, hardier, but not unique provides supplemental information increasing the ability to make a statistical match - maternal inheritance