1.Hybridization (DNA-DNA or DNA-RNA)

HYBRIDIZATION? – Yes, it is about this familiar picture

We can denaturate and renaturate DNA by heating/cooling

As DNA is heated, it reaches a temperature where the strands separate (DNA melts). medlib.med.utah.edu/block2/ biochem/ ssDNA H-bonds between basepairs are broken and the strand unwind. Unstacked bases (random orientation) absorb more light than neatly stacked (oriented) base-pairs Melting curve. The temperature at which DNA is half unfolded Tm (melting temp ) Tm is a measure of the stability of dsDNA under a given set of conditions Hypochromic Shift

Tm of DNA is affected by: 1. Base Composition : higher the GC content, the higher the Tm. 2. Ionic Strength : as the ionic strength increases, so does Tm. Double helical DNA is stabilized by cations. Divalent cations (Mg2+) are more effective than monovalent cations (NA+ or K+). 3. Organic Solvents – formamide for instance lowers the Tm by weakening the hydrophobic interactions.

medlib.med.utah.edu/block2/ biochem/ DNA more STABLE in high-salt conditions. DNA more STABLE When contains many GC

RNA can bind DNA (U is equivalent of T in hybridization)

Hybridization could be less than perfect

medlib.med.utah.edu/block2/ biochem/ COMPLEX (DYNAMIC) PICTURE IN SOLUTION

42 C is more stringent condition that 35 C (hybridization is more specific)

So, hybridization is a most obvious phenomenon to use for specific DNA detection Specific probe self-anneals to target DNA Only problem – DNA is invisible How to visualize DNA? Radioactively Fluorescently

Polymerase labeling of DNA Gamma-33-ATPAlpha-32-ATP

Labeling by NICK TRANSLATION DNAse I Polymerase I (exonuclease activity) Polymerase I (polymerase activity) Will work without DNAse, as there are always nicks in DNA

T4 polynucleotide kinase labeling Gamma-33-ATP olig dNTP Used for oligonucleotide labeling

Professor Sir Ed Southern, Whitley Professor of Biochemistry at the University of Oxford.

Allison, Fundamental Molecular Biology

Real Southern blot (DNA-DNA blot) _Southern_Blot_analysis.htm STAINED by Et BrVIZUALIZED by P32

Western Blot

Southernnorthern western What different types of information can be provided by each different blot type?

Colony hybridization assay for the identification of bacterial colonies carrying a particular DNA clone

Same for arrayed clones

Design of degenerated synthetic hybridization probes (for already known proteins only)

The degeneracy of a primer is the number of unique sequences it corresponds to (5 in one of the examples below). can be used when some of the related genomic sequences are unknown, or known only in a related species. Up to degeneracy is tolerated

Fluorescent probe hybridization A DNA probe, covalently bound to biotin, is hybridized to a denatured chromosome preparation. An avidin-bound fluorescent label (FITC) is layered on top of the cells, and the avidin-FITC binds the biotin. The signal is amplified further by layering rabbit anti-avidin antibody (which binds the avidin-FITC), and then layering FITC-labeled anti-rabbit antibody on top. Fluorescence will be detected only where the DNA probe has hybridized to the chromosome.

How streptavidin/biotin binding is working? Largest free energies of association of yet observed for noncovalent binding of a protein and small ligand in aqueous solution (K_assoc = 10**14). Complex is extremely stable. Streptavidin is a protein. 1 mole of SA binds 4 moles Bio BIOTIN is a vitamin B (small thing) Biotin could be added to nucleotide and incorporated into the probe (67 kD protein from Streptococcus avidinii) Avidin could be conjugated with fluorophore

IN SITU HYBRIDIZATION is an imaging method to visualize mRNA expression in tissues and cells. Encephalin gene expression in the mouse brain Core/InSitu.asp The HuC transcript is expressed specifically in the nervous system of this E18 mouse

FISH labeling of the centromeric highly repeated DNA Metaphase FISH analysis using the BAC probe RP11-104M2 labeled with FITC (green) hybridized to a normal metaphase cell confirms the chromosomal localization of the probe (gene) to 4q28.

Cy3/Cy5 direct labelling of DNA (for microarrays) Cy5 -- RED

2. Polymerase chain reaction (PCR)

Polymerase Chain Reaction (PCR) ww2.mcgill.ca/biology/undergra/ c200a/f07-16.gif DNA melting Primer annealing DNA elongation Nobel Prize in Chemistry 1993, at age 48 Kary Mullis (invented PCR in 1983) PhD "The Cosmological Significance of Time Reversal," Biochemistry from U.C. Berkeley

Exponential nature of PCR amplification

pe/Sld022.htm

use OLIGONEW or PRIMER software Try for equal Tm for both primers

Avoid primer dimer formation Marginally problematic primer

Use Software to avoid of such problems

Typical PCR gel (Every PCR should by gel-verifyed)

Fidelity of PCR is often an issue pe/Sld022.htm mkM

pe/Sld022.htm Proof-reading activity enzymes are required for High Yield and High Fidelity are mutually exclusive

pe/Sld022.htm

If complete copies is amplified pe/Sld022.htm

Plateau effect in PCR reaction

pe/Sld022.htm Plateau effect in PCR reaction

Non-specific PCR and how to improve it Just PCR 5% D M S O DMSO+GLYDMSO+GLY MARKERMARKER Decrease in Mg concentraton

PCR enzymes Taq DNA polymerase, the first enzyme used for PCR, is still the most popular. -- high processivity -- is the least expensive choice -- generates PCR products with single A overhangs on the 3´-ends (Suitable for TOPO-cloning) Topo cloning system (Invitrogen) Half-life at 95C is 1.6 hours

Tth polymerase Thermus thermophilus strain HB8. RNA-dependent DNA-polymerase activity in the presence of Mn2+ ions. DNA-dependent DNA-polymerase activity in the presence of Mg2+ ions. The fragment should be ideally smaller 1 kb. Mn 2+ Mg 2+

Pfu polimerase Proofreading or high fidelity DNA polymerases (from Pyrococcus furiosus). approx.1 / 2, 000,000 nucleotides before making an error. In comparison Taq DNA polymerase makes an error in approx. every 1/ 10,000 nucleotides. can tolerate temperatures exceeding 95°C, enabling it to PCR amplify GC-rich targets. more expensive

Pol Vent (From Thermococcus litoralis) also known as Tli polymerase Very termostable: Half-life at 95 C is approximately 7 hours Vent error rate is intermediate between Taq and Pfu. 2-5 x 10-5 errors/bp 3'->5' exonuclease activity presents Other polymerases: Deep Vent (Pyrococcus species GB-D) (New England Biolabs) New England Biolabs claims fidelity is equal to or greater than that of Vent. Replinase (Thermus flavis) 1.03 x 10-4 errors/base

Long-Range PCR Use of two polymerases: a non-proofreading polymerase Taq is the main polymerase in the reaction, a proofreading polymerase (3' to 5' exo) Pwo is present at a lower concentration kb PCR products are achieved on Qiagen and Eppendorf PCR mixes Taq+ Pwo (Pyrococcus woesei) ; Pwo is very stable, 2 hrs at 100 C

3. SEQUENCING: (Sanger method) Sanger method: Frederick Sanger (Nobel prize 1980 with Paul Berg and Walter Gilbert)

Dideoxynucleotide blocks chain elongation

DNA sequencing: chemistry, with terminator dyes * * * * * * * * * * * * * *

Semi-automated fluorescent DNA sequencing: template + polymerase + dCTP dTTP dGTP dATP ddATP ddGTP ddTTP ddCTP extension electrophoresis ATGCATTACGTAGCGCATGCTATACGTAGCATATGCATTACGTAGCGCATGCTATACGTAGCAT

Cycle Sequencing - PCR

Applied Biosystems Inc., have designed an automated method that combines the PCR and actual sequencing

DNA sequencing by primer walking

Chemical synthesis of DNA Chain grows: 3-> 5

General consideration about Gene Expression Expression Host -> Expression System Promoter system -> expression vector Properties of product -> stability Production level

Comparison of expression systems

Use of Lac promoter (pLac) for expression of foreign protein

Prokaryotic Expression vector

PstI T7/la c phoAcutinase NarI SalI HindIII BamHI phoA-cut NdeI S/D Term pFCEX1

Eukaryotic Expression vector

Promoters

Control of transcription of the lac operon. Page 95

Terminators

Northern Blot -> to study transcription level

Expression studies by microarray technique